View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1386_low_34 (Length: 283)
Name: NF1386_low_34
Description: NF1386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1386_low_34 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 50 - 283
Target Start/End: Original strand, 36129190 - 36129424
Alignment:
| Q |
50 |
catcatcaccaccaacaacaacaatttcagcctgattttattacacctaaaatgttattaacaactagaaagcatgtttaaaaaccaatacaccatacac |
149 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36129190 |
catcaccaccaccaacaacaacaatttcagcctgattttactacacctaaaatgttattaacaactagaaagcatgtttaaaaaccaatacaccatacac |
36129289 |
T |
|
| Q |
150 |
tatacgaacaccatagacgatacata-atgatataagataaatgaatttggacccttgttttaatattagttgatatctaaatcataattgatgaagcaa |
248 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36129290 |
tatacgaacaccatagactatacatatatgatataagataaatgaatttggacccttgttttaatattagttgatatctaaatcataattgatgaggcaa |
36129389 |
T |
|
| Q |
249 |
tgcaacaatgcgacacgcgggcagttacacgcata |
283 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||| |
|
|
| T |
36129390 |
tgacacaatgcgacacgcgggcagttacacgcata |
36129424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University