View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1386_low_35 (Length: 277)
Name: NF1386_low_35
Description: NF1386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1386_low_35 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 44 - 247
Target Start/End: Original strand, 37145691 - 37145894
Alignment:
| Q |
44 |
gagtgcactcaagatgcctctggaatggggaaacaaagaaggtgtgtcgtgcttggagcggcactcactgaaatttgagattcaattggtgtagtcaaat |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37145691 |
gagtgcactcaagatgcctctggaatggggaaacaaagaaggtgtgtcgtgcttggagcggcactcactgaaatttgagattcaattggtgtagtcaaat |
37145790 |
T |
 |
| Q |
144 |
acatgataagaaagaaagtttagtgggtactccagaaaatagtaaagatgaaaagatgtatcatgtacaaatttaccagtagaaaggccaaagagtataa |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37145791 |
acatgataagaaagaaagtttagtgggtactccagaaaatagtaaagatgaaaagatgtatcatgtacaaatttaccagtagaaaggccaaagagtataa |
37145890 |
T |
 |
| Q |
244 |
tcta |
247 |
Q |
| |
|
|||| |
|
|
| T |
37145891 |
tcta |
37145894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University