View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1386_low_45 (Length: 247)
Name: NF1386_low_45
Description: NF1386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1386_low_45 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 149 - 247
Target Start/End: Original strand, 42358239 - 42358346
Alignment:
| Q |
149 |
atttcacggtggattcacaaaataaacccaaaccagaaccactattgct---------tttaatttcaaaagatgcttgaaacgattaactacctaatcg |
239 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
42358239 |
atttcacggtggattcaccaaataaacccaaaccagaaccactattgcttgcttcagatttaatttcacaagatgcttgaaacgattaaatacctaatcg |
42358338 |
T |
|
| Q |
240 |
gatcggcg |
247 |
Q |
| |
|
|||||||| |
|
|
| T |
42358339 |
gatcggcg |
42358346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 42 - 90
Target Start/End: Original strand, 42358186 - 42358234
Alignment:
| Q |
42 |
atctaagcatagcatactgacagtgtatgtaaaagataaccaaccacct |
90 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42358186 |
atctaagcatagcatactgacagtgtatgtaaaagataaccaaccacct |
42358234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University