View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1386_low_47 (Length: 237)
Name: NF1386_low_47
Description: NF1386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1386_low_47 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 20 - 224
Target Start/End: Original strand, 43560878 - 43561082
Alignment:
| Q |
20 |
aaccttaacattgttaccacccacattatgaataacgttcaccttgaaccacctattatagatatttggagacagaacaggacccctataataatttaat |
119 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43560878 |
aaccttaacattgttagcacccacattatgaataacgttcaccttgaaccacctattatagatatttggagacagaacaggatccctataataatttaat |
43560977 |
T |
 |
| Q |
120 |
gaaccatcatagaccctaagctgtgaggttgtcgaagtaggatttgcaccaaacacttgcataatacacactcctgatgtgccccctggaacataaccct |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43560978 |
gaaccatcatagaccctaagctgtgaggttgtcgaagtaggatttgcaccaaacacttgcataatacacactcctgatgtgccccctggaacataaccct |
43561077 |
T |
 |
| Q |
220 |
gccct |
224 |
Q |
| |
|
||||| |
|
|
| T |
43561078 |
gccct |
43561082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University