View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13871_high_5 (Length: 227)

Name: NF13871_high_5
Description: NF13871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13871_high_5
NF13871_high_5
[»] chr4 (1 HSPs)
chr4 (1-111)||(21449719-21449829)


Alignment Details
Target: chr4 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 1 - 111
Target Start/End: Complemental strand, 21449829 - 21449719
Alignment:
1 cccagatgggctactgagattgatttaagattaaatttcgttttttgagttttgtctaatgtgcgtagagactagtcccttgagtcacgtcaacccagtt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||    
21449829 cccagatgggctactgagattgatttaagattaaatttcgttttttgagttttgtctaatgtgcgtagagactagtccctcgagtcgcgtcaacccagtt 21449730  T
101 gggctattgaa 111  Q
    |||||||||||    
21449729 gggctattgaa 21449719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University