View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13871_low_5 (Length: 227)
Name: NF13871_low_5
Description: NF13871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13871_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 1 - 111
Target Start/End: Complemental strand, 21449829 - 21449719
Alignment:
| Q |
1 |
cccagatgggctactgagattgatttaagattaaatttcgttttttgagttttgtctaatgtgcgtagagactagtcccttgagtcacgtcaacccagtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
21449829 |
cccagatgggctactgagattgatttaagattaaatttcgttttttgagttttgtctaatgtgcgtagagactagtccctcgagtcgcgtcaacccagtt |
21449730 |
T |
|
| Q |
101 |
gggctattgaa |
111 |
Q |
| |
|
||||||||||| |
|
|
| T |
21449729 |
gggctattgaa |
21449719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University