View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13874_high_4 (Length: 212)
Name: NF13874_high_4
Description: NF13874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13874_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 16 - 191
Target Start/End: Complemental strand, 52851256 - 52851081
Alignment:
| Q |
16 |
atgaatagatgatgaagatgaatataggtaggaagcatttactttaatttaatcactatcatcttacannnnnnnncaatgatagaacgaaacctagaag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
52851256 |
atgaatagatgatgaagatgaatataggtaggaagcatttactttaatttaatcactatcatcttacatttcttttcaatgatagaacgaaacctagaag |
52851157 |
T |
|
| Q |
116 |
ataaaagtagaagtaaactgcaacactaatttaaccgacctgagtttgaattgctgaaatgtcccctttttccccc |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
52851156 |
ataaaagtagaagtaaactgcaacactaatttaaccgacctgaatttaaattgctgaaatgtcccctttttccccc |
52851081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University