View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13875_low_2 (Length: 348)
Name: NF13875_low_2
Description: NF13875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13875_low_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 74; Significance: 7e-34; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 190 - 333
Target Start/End: Complemental strand, 14743095 - 14742951
Alignment:
| Q |
190 |
atgttgtgatggaatttatgtacgcttgacacattagatttgaaggtgtgtttgattacaaacatgttttggtttcaggtcc-aaaaacgctaattannn |
288 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||| ||| ||||| ||||| || |
|
|
| T |
14743095 |
atgttgtgatggaatttacgtacgcttgacacattagatttgaaggtgtctttgattacaaacatgttttggtgtcagatccaaaaaaagctaaatattt |
14742996 |
T |
 |
| Q |
289 |
nnnnnnnnnnaaatcattaccaacatatatgttagtattgtatat |
333 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
14742995 |
ctatttttttaaatcattaccaacatatatgttagtattgtatat |
14742951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 98 - 205
Target Start/End: Complemental strand, 14743239 - 14743143
Alignment:
| Q |
98 |
atgattttctcatgtatcgatcttcgttttatttccctgtttttatgtctctttcttttatatcgatttgtagcgactattttatattgtgtatgttgtg |
197 |
Q |
| |
|
|||||||||||||||||| ||||| ||| |||| |||||||| |||| |||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
14743239 |
atgattttctcatgtatcaatctttgttgaattttcctgtttt-atgtttctttcttttttatcga----------ctattttatattgtgtatgttgtg |
14743151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 71; Significance: 4e-32; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 190 - 276
Target Start/End: Original strand, 17583987 - 17584073
Alignment:
| Q |
190 |
atgttgtgatggaatttatgtacgcttgacacattagatttgaaggtgtgtttgattacaaacatgttttggtttcaggtccaaaaa |
276 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
17583987 |
atgttgtgatggaatttacgtacgcttgacacattagatttgaaggtgtctttgattacaaacatgttttggtgtcagatccaaaaa |
17584073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 98 - 205
Target Start/End: Original strand, 17583843 - 17583939
Alignment:
| Q |
98 |
atgattttctcatgtatcgatcttcgttttatttccctgtttttatgtctctttcttttatatcgatttgtagcgactattttatattgtgtatgttgtg |
197 |
Q |
| |
|
|||||||||||||||||| ||||| |||| |||| |||| |||||||| |||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
17583843 |
atgattttctcatgtatcaatctttgtttaattttcctg-ttttatgtttctttcttttttat----------cgactattttatattgtgtatgttgtg |
17583931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 299 - 333
Target Start/End: Original strand, 17584097 - 17584131
Alignment:
| Q |
299 |
aaatcattaccaacatatatgttagtattgtatat |
333 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
17584097 |
aaatcattaccaacatatatgttagtattgtatat |
17584131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University