View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13875_low_6 (Length: 236)
Name: NF13875_low_6
Description: NF13875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13875_low_6 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 16 - 236
Target Start/End: Original strand, 1331889 - 1332108
Alignment:
| Q |
16 |
atgacaacattcatgtagccaagattcaatttaccacatccattaaaccaactattcggtattataagtgtgatatctgtcatttttcgaagtataacca |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
1331889 |
atgacaacattcatgtagccaagattcaatttaccacatccattaaaccaactattcggtattttaagtgtgatatctgtcatttttcgaagtataacca |
1331988 |
T |
 |
| Q |
116 |
aagtactttttctccgaattgatccgaatgtcttattcattctgatttttggcgaccattccatgtttctagtatttcttgtgtgagattgtttgtttcc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
1331989 |
aagtactttttctccgaattgatccgaatgtcttattcattctgatgtttggcgaccattccatg-ttctagtatttcttgtgtgagattgtttgtttcc |
1332087 |
T |
 |
| Q |
216 |
tttattgatgattgttttcaa |
236 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
1332088 |
tttattgatgattgttttcaa |
1332108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University