View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13876_high_20 (Length: 397)
Name: NF13876_high_20
Description: NF13876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13876_high_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 336; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 336; E-Value: 0
Query Start/End: Original strand, 13 - 382
Target Start/End: Complemental strand, 370858 - 370489
Alignment:
| Q |
13 |
attctagaatgccctttgaaggnnnnnnnnnngttttttacatttaaaatgtagtattctttattccaataccatgattttgactagctgggaaaaggtg |
112 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
370858 |
attctagaatgccctttgaaggaaaaaaaattgttttttacatttaaaatgtagtattctttattccaataccatgattttgactagctgggaaaaggtg |
370759 |
T |
|
| Q |
113 |
acaaaaatggcaaggatgaatttaagaaagtaatcatcgaatttgaggaatctcaactagtgagtttgtgaggacgaaaatgggtttgaatctcaatgtt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
370758 |
acaaaaatggcaaggatgaatttaagaaagtaatcatcgaatttgaggaatctcaactagtgagtttgtgaggacgaaaatgggtttgaagctcaatgtt |
370659 |
T |
|
| Q |
213 |
gtgtctttctttactttgatttttgttctgtaaaagggtttacttactgggactgagggagaaggtagagcatatctgttacaggggctatacagaggtt |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
370658 |
gtgtctttctttactttgatttttgttctgtaaaagggtttacttactgggactgagggagaaggtagagcatatctgttacaggggctatacagaggtt |
370559 |
T |
|
| Q |
313 |
aaggggtggagggggagggaaacggtggagaaaagggatgaagagggagcaaatttggtgtgaaggttct |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
370558 |
aaggggtggagggggagggaaacggtggagaaaagggatgaagagggagcaaatttggtgtgaaggttct |
370489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 109; Significance: 1e-54; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 274 - 382
Target Start/End: Original strand, 43013510 - 43013618
Alignment:
| Q |
274 |
aaggtagagcatatctgttacaggggctatacagaggttaaggggtggagggggagggaaacggtggagaaaagggatgaagagggagcaaatttggtgt |
373 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43013510 |
aaggtagagcatatctgttacaggggctatacagaggttaaggggtggagggggagggaaacggtggagaaaagggatgaagagggagcaaatttggtgt |
43013609 |
T |
|
| Q |
374 |
gaaggttct |
382 |
Q |
| |
|
||||||||| |
|
|
| T |
43013610 |
gaaggttct |
43013618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University