View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13876_high_22 (Length: 381)
Name: NF13876_high_22
Description: NF13876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13876_high_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 153 - 365
Target Start/End: Original strand, 31696803 - 31697015
Alignment:
| Q |
153 |
taccaagtattgctccctttcattctgaatcccacaacctctctcatcaatctattagcaaacaatgtagcttgaaaagtttgatattccttctgagcat |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||| ||||| |
|
|
| T |
31696803 |
taccaagtattgctccctttcattctgaattccacaacctctctcatcaatctattagcaaacaatgtggcttgaaaagtttgacattccttctcagcat |
31696902 |
T |
|
| Q |
253 |
tcctggctcgaaaggtaatatggtaaaagactccattaaccagttgccaaacagccatctcaaaatcgacaaatcggtagtttgtcttcatctttaaatt |
352 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31696903 |
tcctggctctaaaggtaatatggtaaaagactccattaaccagttgccaaacagccatctcaaaatcgacaaatcggtagtttgtcttcatctttaaatt |
31697002 |
T |
|
| Q |
353 |
gtaatcatctatt |
365 |
Q |
| |
|
||||||||||||| |
|
|
| T |
31697003 |
gtaatcatctatt |
31697015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 4 - 87
Target Start/End: Original strand, 31696623 - 31696703
Alignment:
| Q |
4 |
aaaaaatgaggctaaacatattgcaaggggggtggaaaccaatgctatgtatcaaataatttcagatgcagagaaacaaattgg |
87 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||||| |||||||| || |||||||||||||||||||||| ||||| |
|
|
| T |
31696623 |
aaaaaatgaggctaaacatattgcaggggggttggaaaccattgctatgt---aagtaatttcagatgcagagaaacatattgg |
31696703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000009; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 44797570 - 44797626
Alignment:
| Q |
30 |
ggggggtggaaaccaatgctatgtatcaaataatttcagatgcagagaaacaaattg |
86 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||| ||||||| ||||||| |||| |
|
|
| T |
44797570 |
ggggggtggaaagcattgctatgtatcaaataatttgagatgcaaagaaacatattg |
44797626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 46 - 86
Target Start/End: Complemental strand, 39845752 - 39845712
Alignment:
| Q |
46 |
tgctatgtatcaaataatttcagatgcagagaaacaaattg |
86 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||| |||| |
|
|
| T |
39845752 |
tgctatgtatgaaataatttcagatgcaaagaaacatattg |
39845712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University