View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13876_high_31 (Length: 284)
Name: NF13876_high_31
Description: NF13876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13876_high_31 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 40886925 - 40887163
Alignment:
| Q |
1 |
gtgaatacctattaattaccgagagacaaacacacagatagagcaacaatatagttgcattaattcaccacacccataattatttctggtaagcattatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40886925 |
gtgaatacctattaattaccgagagacaaacacatagatagagcaacaatatagttgcattaattcaccacacccataattatttctggtaagcattatt |
40887024 |
T |
 |
| Q |
101 |
ttgacttgaataaataactttttggtgagatagtttaaaggccaactaaggagcattgagatgttcccatcaactttccattcttatcactaattttgtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40887025 |
ttgacttgaataaataactttttggtgagatagtttaaaggccaactaaggagcattgagatgttcccatcaactttccattcttatcactaattttgtt |
40887124 |
T |
 |
| Q |
201 |
ctgc-aattttgatcttgtgttgatctcctttatcaatt |
238 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
40887125 |
ctgcaaattttgatcttgtgttgatctcctttatcaatt |
40887163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University