View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13876_low_33 (Length: 320)
Name: NF13876_low_33
Description: NF13876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13876_low_33 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 94; Significance: 7e-46; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 14 - 107
Target Start/End: Complemental strand, 27833869 - 27833776
Alignment:
| Q |
14 |
ttattcttggtattattatagttaagaggtgctaggagttctttcataacattgaattgcattgaatcctcagggctcatatccaccatggccg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27833869 |
ttattcttggtattattatagttaagaggtgctaggagttctttcataacattgaattgcattgaatcctcagggctcatatccaccatggccg |
27833776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University