View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13876_low_38 (Length: 271)
Name: NF13876_low_38
Description: NF13876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13876_low_38 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 74 - 250
Target Start/End: Complemental strand, 35701565 - 35701389
Alignment:
| Q |
74 |
agacaaatagtttttggtgtttgccctataaatgttttcaaagatctctgatatctaaattgaaatgtcgcgaacaaattatttaatgtttatatacaat |
173 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
35701565 |
agacaaatagtttttggtgtttgccctagaaatgttttcaaagatctctgatatctaaattgaaatgtcgtgaacaaattatttaatgtttatatacaat |
35701466 |
T |
|
| Q |
174 |
actagctatattagtgcaactttgtgatgaaactattcagatatcaaatagcatcatgatatcacacatgataaatg |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35701465 |
actagctatattagtgcaactttgtgatgaaactattcagatatcaaatagcatcatgatatcacacatgataaatg |
35701389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University