View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13876_low_41 (Length: 249)
Name: NF13876_low_41
Description: NF13876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13876_low_41 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 57; Significance: 7e-24; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 134 - 238
Target Start/End: Complemental strand, 31610657 - 31610553
Alignment:
| Q |
134 |
tcaccatgtttaggaccgaacaactaaaatataatcatttggtttgaataacccattagcggatggtcaaatggatttcttataagctctaatatcattt |
233 |
Q |
| |
|
|||||| |||||||| ||||||| |||||| |||||| || | |||||| |||||||||||| |||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
31610657 |
tcaccacgtttaggatcgaacaattaaaatgtaatcacttagcttgaatgacccattagcgggtggtcaaatggatttcttataaactctaatgccattt |
31610558 |
T |
|
| Q |
234 |
tagaa |
238 |
Q |
| |
|
||||| |
|
|
| T |
31610557 |
tagaa |
31610553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 18 - 63
Target Start/End: Complemental strand, 31610773 - 31610728
Alignment:
| Q |
18 |
aatgattcattcaattttagtatttgaggataactaaaccttatag |
63 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
31610773 |
aatgattcattcaattttagtatttgagtataactaaaccttatag |
31610728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University