View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13876_low_43 (Length: 245)
Name: NF13876_low_43
Description: NF13876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13876_low_43 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 106 - 242
Target Start/End: Original strand, 41699006 - 41699141
Alignment:
| Q |
106 |
ggtttgtattttttgatatttttatcttagaaaaaattctataagaaaatttttcaaccgtatacttttctagcgcgccatannnnnnnccataaatatc |
205 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
41699006 |
ggttagtatttttttatatttttatcttagaaaaaattctataagaaattttttcaaccgtatacttttctagcgcgtcata-ttttttccataaatatc |
41699104 |
T |
|
| Q |
206 |
cttgagcattttggattatataattcaagaataattt |
242 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
41699105 |
cttgagcattttggattatataattcaaaaataattt |
41699141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 20 - 70
Target Start/End: Original strand, 41698920 - 41698970
Alignment:
| Q |
20 |
cgtattactaagattatcttagtaatgaacacacaaataatcttgtacacg |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41698920 |
cgtattactaagattatcttagtaatgaacacacaaataatcttgtacacg |
41698970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University