View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13876_low_46 (Length: 229)
Name: NF13876_low_46
Description: NF13876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13876_low_46 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 9e-60; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 93 - 213
Target Start/End: Original strand, 26580478 - 26580598
Alignment:
| Q |
93 |
ctaagttgaatcaaccattgttttactctaaccaaatagtgggaaatttcttttgaaatttcaatgaactatcaaagtctatatgcatttcaggattacc |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26580478 |
ctaagttgaatcaaccattgttttactctaaccaaatagtgagaaatttcttttgaaatttcaatgaactatcaaagtctatatgcatttcaggattacc |
26580577 |
T |
 |
| Q |
193 |
attagtcagagactcataagt |
213 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
26580578 |
attagtcagagactcataagt |
26580598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 5 - 96
Target Start/End: Original strand, 26579415 - 26579506
Alignment:
| Q |
5 |
agaaaattgatcattgtaatgtaaaacactagtagttgagtcctaatcaaacgtctgaaagagttgttaagtactcgtggagacataactaa |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
26579415 |
agaaaattgatcattgtaatgtaaaacactagtagttgagtcctaatcaaacgtctcaaagagttgttaagtactcgtggagacataactaa |
26579506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University