View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13876_low_49 (Length: 215)
Name: NF13876_low_49
Description: NF13876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13876_low_49 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 1 - 172
Target Start/End: Complemental strand, 4970294 - 4970123
Alignment:
| Q |
1 |
aaagttgaatacaaacaaaatttaattaaatctttgtgatttttataataaatattttttatgagggtttgtttgtttctctaatattgctgccttttta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4970294 |
aaagttgaatacaaacaaaatttaattaaatctttgtgatttttataataaatattttttatgagggtttgtttgtttctctaatattgctgtcttttta |
4970195 |
T |
 |
| Q |
101 |
aggatgatcttagaggatcctctcttcgaccatctgcttcattatgaggttgtttgttctttttctctatgg |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4970194 |
aggatgatcttagaggatcctctcttcgaccatctgcttcattatgaggttgtttgttctttttctctatgg |
4970123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 4 - 170
Target Start/End: Complemental strand, 28571204 - 28571037
Alignment:
| Q |
4 |
gttgaatacaaacaaaatttaattaaatctttgtgatttttataataaatattttttatgagggtttgtttgtttctctaatattgctgcc-tttttaag |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
28571204 |
gttgaatacaaacaaaatttaattaaatctttgtgatttttattataaatattttttagaagggtttgtttgtttctctaatattgatgccttttttaag |
28571105 |
T |
 |
| Q |
103 |
gatgatcttagaggatcctctcttcgaccatctgcttcattatgaggttgtttgttctttttctctat |
170 |
Q |
| |
|
||||||||||||||||||||||||||| | |||||||||| |||||| |||||| || |||||||||| |
|
|
| T |
28571104 |
gatgatcttagaggatcctctcttcgaacgtctgcttcatcatgaggatgtttgctcgttttctctat |
28571037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University