View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13877_low_3 (Length: 232)
Name: NF13877_low_3
Description: NF13877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13877_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 5 - 217
Target Start/End: Original strand, 36527291 - 36527503
Alignment:
| Q |
5 |
agaggtagtttgggctgggttgatgagtgttttcaatgtatgcttttgtggaaatgcttgtggggcagatgtgaaacatcacggatgaatagcatcgagg |
104 |
Q |
| |
|
|||||||||||||||||| ||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36527291 |
agaggtagtttgggctggtttgattattgttttcaatgtatgcttttgtggaaatgcttgtggggcagatgtgaaacatcacggatgaatagcatcgagg |
36527390 |
T |
|
| Q |
105 |
cttgtactgttttgatatgatcatgtgaagatgcgagacaatgaagtgtcatttgtattgttttcttgagccacttgaagcatggttattcttgttattg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36527391 |
cttgtactgttttgatatgatcatgtgaagatgccagacaatgaagtgtcatttgtattgttttcttgagccacttgaagcatggttattcttgttattg |
36527490 |
T |
|
| Q |
205 |
gtgcgaattatgt |
217 |
Q |
| |
|
||||||||||||| |
|
|
| T |
36527491 |
gtgcgaattatgt |
36527503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 58 - 118
Target Start/End: Original strand, 36553935 - 36553995
Alignment:
| Q |
58 |
atgcttgtggggcagatgtgaaacatcacggatgaatagcatcgaggcttgtactgttttg |
118 |
Q |
| |
|
||||||| || ||| ||||||||||| | ||||||||||||||||||||| |||||||||| |
|
|
| T |
36553935 |
atgcttgaggagcaaatgtgaaacattaaggatgaatagcatcgaggcttctactgttttg |
36553995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University