View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13878_low_38 (Length: 206)
Name: NF13878_low_38
Description: NF13878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13878_low_38 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 28 - 190
Target Start/End: Original strand, 39508115 - 39508277
Alignment:
| Q |
28 |
ctccctcaatagaaacaaaacaagaacaaccaaattagtacatattgccacaagctccaaaagaggcaatccaaggatcttactgaaaagggtattccac |
127 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39508115 |
ctccctcaatagaaacaaaacaagaacagccaaattagtacatattgcaacaagctccaaaacaggcaatccaaggatcttactgaaaagggtattccac |
39508214 |
T |
 |
| Q |
128 |
aatgacccttttgaagaatacaacgttgtaggcaagatttcattgagagccatgaggaaaaag |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39508215 |
aatgacccttttgaagaatacaacgttgtaggcaagatttcattgagagccatgaggaaaaag |
39508277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University