View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13879_low_10 (Length: 245)
Name: NF13879_low_10
Description: NF13879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13879_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 37422579 - 37422365
Alignment:
| Q |
18 |
attccgtttttactaatgcaacttttttaaagaatttcttgtttgtattagatttcataataaaaactttttgttgatgtcgtcaatgcttaaacctaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37422579 |
attccgtttttactaatgcaacttttttaaagaatttcttgtttgtattagatttcataataaaaactttttgttgatgtcgtcaatgcttaaacc---- |
37422484 |
T |
|
| Q |
118 |
ccgcttctgcaaatttttcctttattcagaatgccgaaaatatattcggcatacatgtggtgtaaattttgcctacactgtgcaccaccaaaaggatgca |
217 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37422483 |
--gcttctacaaatttctcctttattcagaatgccgaaaatatattcggcatacatgtggtgtaaattttgcctacactgtgcaccaccaaaaggatgca |
37422386 |
T |
|
| Q |
218 |
gtaatgccctaatcctctctg |
238 |
Q |
| |
|
|||||||||| |||||||||| |
|
|
| T |
37422385 |
gtaatgccctcatcctctctg |
37422365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University