View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13879_low_15 (Length: 211)
Name: NF13879_low_15
Description: NF13879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13879_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 31 - 193
Target Start/End: Complemental strand, 24937367 - 24937205
Alignment:
| Q |
31 |
atatatataatgcattgattcgtatcttcaaaagtataatccattaatccaagattaacaaactgcatgttatgctttcattttattttatgttatgtga |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
24937367 |
atatatataatgcattgattcgtatcttcaaaagtataatccattaatccaagattaacaaaccgcatgttatgctttcattttattttatgttatgtga |
24937268 |
T |
 |
| Q |
131 |
aaagttgtacgatgtaattatttgtgtgtctcattctaaagtctaaaaacccactgtaatatg |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
24937267 |
aaagttgtacgatgtaattatttgtgtgtcttattctaaagtctaaaaacccactgtaatatg |
24937205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University