View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1387_high_19 (Length: 263)
Name: NF1387_high_19
Description: NF1387
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1387_high_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 38 - 252
Target Start/End: Original strand, 4662101 - 4662315
Alignment:
| Q |
38 |
aattacgtactacaatctggtagtgacaactcattatatgttgcactttgttggattttaaatgtctcatgtttgtggttgcaatgcagattttgtctga |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4662101 |
aattacgtactacaatctggtagtgacaactcattatatgttgcactttgttggattttaaatgtctcatgtttgtggttgcaatgcagattttgtctga |
4662200 |
T |
 |
| Q |
138 |
ttattacttcaactttaaatgagtcgtgtgtggagtaactttagtttgtggtatttggagtgctcagaagaagaaatttgcaattcgaggcttatgtata |
237 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4662201 |
ttattacttcaaccttaaatgagtcgtgtgtggagtaactttagtttgtggtatttggagtgctcagaagaagaaatttgcaattcgaggcttatgtata |
4662300 |
T |
 |
| Q |
238 |
ttatgtgaaatctgt |
252 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
4662301 |
ttatgtgaaatctgt |
4662315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University