View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1387_high_21 (Length: 205)
Name: NF1387_high_21
Description: NF1387
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1387_high_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 1 - 121
Target Start/End: Complemental strand, 17484818 - 17484698
Alignment:
| Q |
1 |
tgatgaatctgttgaaggaaagtttgttcctaagaagaagcatggcgtacttgcaatccaggtataaaactaaggggtgacaaaatggatggattgaata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
17484818 |
tgatgaatctgttgaaggaaagtttgttcctaagaagaagcatggcgtgctcgcaatccaggtataaaactaaggggtgacaaaatggatgggttgaata |
17484719 |
T |
 |
| Q |
101 |
tattttattcgtacagtaata |
121 |
Q |
| |
|
|||||| |||| ||||||||| |
|
|
| T |
17484718 |
tatttttttcggacagtaata |
17484698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 1 - 121
Target Start/End: Complemental strand, 17507093 - 17506973
Alignment:
| Q |
1 |
tgatgaatctgttgaaggaaagtttgttcctaagaagaagcatggcgtacttgcaatccaggtataaaactaaggggtgacaaaatggatggattgaata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
17507093 |
tgatgaatctgttgaaggaaagtttgttcctaagaagaagcatggcgtgctcgcaatccaggtataaaactatggggtgacaaaatggatggattgaata |
17506994 |
T |
 |
| Q |
101 |
tattttattcgtacagtaata |
121 |
Q |
| |
|
| ||||||||| ||||||||| |
|
|
| T |
17506993 |
tgttttattcggacagtaata |
17506973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University