View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1387_low_10 (Length: 343)

Name: NF1387_low_10
Description: NF1387
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1387_low_10
NF1387_low_10
[»] chr4 (2 HSPs)
chr4 (187-309)||(44285808-44285930)
chr4 (73-158)||(44285952-44286037)


Alignment Details
Target: chr4 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 187 - 309
Target Start/End: Complemental strand, 44285930 - 44285808
Alignment:
187 gtggagattggcagcacaatgatgagccttttttggaaaataaagtaaagcaggggtattttaatatataagatttgataaaataaaagagaaacgctat 286  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44285930 gtggagattggcagcacaatgatgggccttttttggaaaataaagtaaagcaggggtattttaatatataagatttgataaaataaaagagaaacgctat 44285831  T
287 aagattttatgatttgataaaat 309  Q
    |||||||||||| ||||||||||    
44285830 aagattttatgacttgataaaat 44285808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 73 - 158
Target Start/End: Complemental strand, 44286037 - 44285952
Alignment:
73 ataattctatggtccttatttatgacagccgaaggcgacctaagcggaggcttaaaagatttctagcttaatcttttgattacaga 158  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44286037 ataattctatggtccttatttatgacagccgaaggcgacctaagcggaggcttaaaagatttctagcttaatcttttgattacaga 44285952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University