View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1387_low_10 (Length: 343)
Name: NF1387_low_10
Description: NF1387
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1387_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 187 - 309
Target Start/End: Complemental strand, 44285930 - 44285808
Alignment:
| Q |
187 |
gtggagattggcagcacaatgatgagccttttttggaaaataaagtaaagcaggggtattttaatatataagatttgataaaataaaagagaaacgctat |
286 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44285930 |
gtggagattggcagcacaatgatgggccttttttggaaaataaagtaaagcaggggtattttaatatataagatttgataaaataaaagagaaacgctat |
44285831 |
T |
 |
| Q |
287 |
aagattttatgatttgataaaat |
309 |
Q |
| |
|
|||||||||||| |||||||||| |
|
|
| T |
44285830 |
aagattttatgacttgataaaat |
44285808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 73 - 158
Target Start/End: Complemental strand, 44286037 - 44285952
Alignment:
| Q |
73 |
ataattctatggtccttatttatgacagccgaaggcgacctaagcggaggcttaaaagatttctagcttaatcttttgattacaga |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44286037 |
ataattctatggtccttatttatgacagccgaaggcgacctaagcggaggcttaaaagatttctagcttaatcttttgattacaga |
44285952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University