View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1387_low_15 (Length: 304)
Name: NF1387_low_15
Description: NF1387
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1387_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 60 - 289
Target Start/End: Original strand, 53257394 - 53257623
Alignment:
| Q |
60 |
ctccagcgtttctagattatcatggtattcagtacaaagtggtagaagtaaatcctacgaacaagaaagagattaattggtctcattacaagaaggtgcc |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53257394 |
ctccagcgtttctagattatcatggtattcagtacaaagtggtagaagtaaatcctacgaacaagaaagagattaattggtctcattacaagaaggtgcc |
53257493 |
T |
 |
| Q |
160 |
tattgtcaccgttgatggtgaacaattggttgattcttcaggtttgtaattgtcttattaatatttccatttgtggtttattgtgttattatgtatagaa |
259 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53257494 |
tattgtcatcgttgatggtgaacagttggttgattcttcaggtttgtaattgtcttattaatatttccatttgtggtttattgtgttattatgtatagaa |
53257593 |
T |
 |
| Q |
260 |
tgttgttctgaactgtgaactttatccccc |
289 |
Q |
| |
|
||||||||||||||||||||||| |||||| |
|
|
| T |
53257594 |
tgttgttctgaactgtgaactttttccccc |
53257623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University