View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1387_low_23 (Length: 237)
Name: NF1387_low_23
Description: NF1387
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1387_low_23 |
 | |
|
| [»] scaffold0328 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0328 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: scaffold0328
Description:
Target: scaffold0328; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 5 - 103
Target Start/End: Complemental strand, 2862 - 2764
Alignment:
| Q |
5 |
cataaataaaacttcacagaaagaaataaactctcacaaatcataacatacctagagagaaataaactctcacatgataacaacccagagagaaataaa |
103 |
Q |
| |
|
||||||||||||| || | |||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2862 |
cataaataaaactccatataaagaaataaactctcactaatcataacatgtctagagagaaataaactctcacatgataacaatccagagagaaataaa |
2764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 58 - 109
Target Start/End: Complemental strand, 19705939 - 19705890
Alignment:
| Q |
58 |
agagagaaataaactctcacatgataacaacccagagagaaataaactccca |
109 |
Q |
| |
|
||||||||||||||||||||| | | |||||||| |||||||||||||||| |
|
|
| T |
19705939 |
agagagaaataaactctcaca--acagcaacccagggagaaataaactccca |
19705890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 58 - 109
Target Start/End: Complemental strand, 19005019 - 19004970
Alignment:
| Q |
58 |
agagagaaataaactctcacatgataacaacccagagagaaataaactccca |
109 |
Q |
| |
|
||||||||||||||||||||| ||| ||| |||| |||||||||||||||| |
|
|
| T |
19005019 |
agagagaaataaactctcaca--atatcaatccagggagaaataaactccca |
19004970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University