View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1387_low_24 (Length: 234)
Name: NF1387_low_24
Description: NF1387
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1387_low_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 8 - 113
Target Start/End: Original strand, 10688823 - 10688928
Alignment:
| Q |
8 |
caaatatgcaaataatattggtatcgaacaagtttcacgcatattggtattggaggctagctcttacatttttgtagaaaaaacatcacctgtttttcat |
107 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
10688823 |
caaatatgcaaataatattgatatcgaacaagtttcacgcatattggtataggagactagctcttacatttttgaagaaaaaacatcacctgtttttcat |
10688922 |
T |
 |
| Q |
108 |
attctt |
113 |
Q |
| |
|
||||| |
|
|
| T |
10688923 |
tttctt |
10688928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University