View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1388-INSERTION-2 (Length: 114)
Name: NF1388-INSERTION-2
Description: NF1388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1388-INSERTION-2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 104; Significance: 2e-52; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 104; E-Value: 2e-52
Query Start/End: Original strand, 7 - 110
Target Start/End: Original strand, 39560307 - 39560410
Alignment:
| Q |
7 |
atatatttactcagcaatttgtaagatcctagtctaaactcattatataaccgttggttatgccttggtctatgttgcattcgaatacaagtcatataag |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39560307 |
atatatttactcagcaatttgtaagatcctagtctaaactcattatataaccgttggttatgccttggtctatgttgcattcgaatacaagtcatataag |
39560406 |
T |
|
| Q |
107 |
tata |
110 |
Q |
| |
|
|||| |
|
|
| T |
39560407 |
tata |
39560410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University