View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1388-INSERTION-3 (Length: 98)
Name: NF1388-INSERTION-3
Description: NF1388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1388-INSERTION-3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 85; Significance: 4e-41; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 85; E-Value: 4e-41
Query Start/End: Original strand, 7 - 95
Target Start/End: Complemental strand, 14598834 - 14598746
Alignment:
| Q |
7 |
agtgatgtgcttctttttacattggagagtgaccaatccaaatgaagatgcaatatggttatggctcatgtcaattacctgtgagatat |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
14598834 |
agtgatgtgcttctttttacattggagagtgaccaatccaaatgaagatgcaatatggttatggctcatgtcaattacttgtgagatat |
14598746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 1e-19
Query Start/End: Original strand, 11 - 95
Target Start/End: Original strand, 14609646 - 14609730
Alignment:
| Q |
11 |
atgtgcttctttttacattggagagtgaccaatccaaatgaagatgcaatatggttatggctcatgtcaattacctgtgagatat |
95 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |||| ||| ||||||| ||| | ||||||||||| |||||||||| |
|
|
| T |
14609646 |
atgtgcttctttttacattggagagtgacacatccaaataaagaggcagtatggttgtgggttatgtcaattacttgtgagatat |
14609730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University