View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13880_high_23 (Length: 306)
Name: NF13880_high_23
Description: NF13880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13880_high_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 32 - 289
Target Start/End: Original strand, 55506458 - 55506706
Alignment:
| Q |
32 |
cgaacaacaattcctaaatttagactttgttgatgttgtttgctttgtactcttgttcccttgccatggtttatccccctggattttcctgacaaggtct |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55506458 |
cgaacaacaattcctaaatttagactttgttgatgttgtttgctttgtactcttgttcccttgccatggtttatccccctggattttcctgacaaggtct |
55506557 |
T |
 |
| Q |
132 |
tattgatgcaaatgttgagttcgcttcgttcgttttggtctatcgccgtctttctatcattcgctttattttcataatatctctagaatggcggctaagg |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || ||||||||||| ||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55506558 |
tattgatgcaaatgttgagttcgcttcgttcgcacaagt--------gtctttctatctttctctttattttcataatatctctagaatggcggctaagg |
55506649 |
T |
 |
| Q |
232 |
ggtactaaacgtagttgtaatgtcttgattttgtctttgcacactctgccgttgaaag |
289 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
55506650 |
ggtact-aacgtagttgtaatgtcttgattttgtctttgcacactctgctgttgaaag |
55506706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 114 - 161
Target Start/End: Original strand, 43996514 - 43996561
Alignment:
| Q |
114 |
attttcctgacaaggtcttattgatgcaaatgttgagttcgcttcgtt |
161 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
43996514 |
attttcctcacaaggtcttattgatgtgaatgttgagttctcttcgtt |
43996561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University