View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13880_low_25 (Length: 242)
Name: NF13880_low_25
Description: NF13880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13880_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 9e-88; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 63 - 226
Target Start/End: Complemental strand, 52476509 - 52476346
Alignment:
| Q |
63 |
ataaatgtgaggaaggaagtacatgaaccaaaacaattttttgtaatgcagctagcttgtaaagcgatgtgcaagatgctaataagcattgagagtagcc |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52476509 |
ataaatgtgaggaaggaagtacatgaaccaaaacaattttttgtaatgcagctagcttgtaaagcgatgtgcaagatgctaataagcattgagagtagcc |
52476410 |
T |
 |
| Q |
163 |
atgaactagcaatgatgcacaaggatgttgctcgtgtgtctgaagcaatgcttgcgttcccttt |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52476409 |
atgaactagcaatgatgcacaaggatgttgctcgtgtgtctgaagcaatgcttgcgttcccttt |
52476346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 52476576 - 52476533
Alignment:
| Q |
1 |
aggtggtacgagtaaaaaagttcaattaaaactaaattgataat |
44 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52476576 |
aggtgctacgagtaaaaaagttcaattaaaactaaattgataat |
52476533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University