View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13880_low_28 (Length: 238)
Name: NF13880_low_28
Description: NF13880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13880_low_28 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 124 - 221
Target Start/End: Complemental strand, 28573713 - 28573616
Alignment:
| Q |
124 |
aggtttgatttgtgggtatttagatttttgagtgtgttggggttggtatcaagaaatatgaatatgatgagaaggttgaaaagcattgcttctggaag |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28573713 |
aggtttgatttgtgggtatttagatttttgagtgtgttggggttggtatcaagaaatatgaatatgatgagaaggttgaaaagcattgcttctggaag |
28573616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University