View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13880_low_32 (Length: 226)
Name: NF13880_low_32
Description: NF13880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13880_low_32 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 9 - 226
Target Start/End: Complemental strand, 26462260 - 26462042
Alignment:
| Q |
9 |
gaatacattgtaagagagaataacatcatgtggtg-tataatcagagaggcagcagtgatgatgagtggattgacaatttttctaaaattttagatgcgt |
107 |
Q |
| |
|
|||||||||||||| ||||| ||||||||| |||| ||| ||||||||||||||||||||||||||||||||||||| | |||||||||||||||| || |
|
|
| T |
26462260 |
gaatacattgtaagggagaacaacatcatgcggtggtatcatcagagaggcagcagtgatgatgagtggattgacaacgtctctaaaattttagatgggt |
26462161 |
T |
 |
| Q |
108 |
gtagttttattattattaggaaaatacnnnnnnngagtaaattattagaaaaatatcaacgagtgcatttgaatactctttaaaaatcataagttataag |
207 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26462160 |
acagttttattattataaggaaaatactttttttgagtaaattattagaaaaatactaacgagtgcatttgaatactctttaaaaatcataagttataag |
26462061 |
T |
 |
| Q |
208 |
tatttataaaaatgtatgt |
226 |
Q |
| |
|
||||||||||||| ||||| |
|
|
| T |
26462060 |
tatttataaaaatatatgt |
26462042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University