View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13880_low_34 (Length: 224)
Name: NF13880_low_34
Description: NF13880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13880_low_34 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 5e-80; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 179
Target Start/End: Complemental strand, 44899863 - 44899685
Alignment:
| Q |
1 |
aaacccctcaggttttgacacatgaagagctaacacatttccagcagggtaaacatccaccttcaaatatgacataaacaatctggtcagacatgcattt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44899863 |
aaacccctcaggttttgacacatgaagagctaacacatttccagcagggtaaacagccaccttcaaatatgacataaacaatctggtcagacatgcattt |
44899764 |
T |
|
| Q |
101 |
tgagataggagtannnnnnnngttcccttttatgcatgtaacttttaaatattagccaaaaggtaagagctaacatcaa |
179 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44899763 |
tgagataggagtattttttttgttcccttttatgcatgtaacttttaaatattagccaaaaggtaagagctaacatcaa |
44899685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 44916086 - 44915992
Alignment:
| Q |
1 |
aaacccctcaggttttgacacatgaagagctaacacatttccagcagggtaaacatccaccttcaaatatgacataaacaatctggtcagacatgcat |
98 |
Q |
| |
|
|||||||| ||| ||||||| ||||||||| |||||||||| |||| |||||| ||||||||||||| |||| | | ||| ||||||||||||||| |
|
|
| T |
44916086 |
aaacccctgaggctttgacatatgaagagccaacacatttc---caggataaacagccaccttcaaataggacacacaaaatttggtcagacatgcat |
44915992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University