View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13880_low_36 (Length: 208)
Name: NF13880_low_36
Description: NF13880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13880_low_36 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 1 - 154
Target Start/End: Original strand, 5830656 - 5830809
Alignment:
| Q |
1 |
ttcccgcgtctcgagatcaattgtgtcaaaatgtacgatatatgaatcgccacatgatcaccaaacataggcaacactgacatttcttgggggccttcag |
100 |
Q |
| |
|
||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5830656 |
ttcccgcatatcgagatcaattgtgtcaaaatgtacgatatatgaatcgccacatgatcaccaaacataggcaacactgacatttcttgggggccttcag |
5830755 |
T |
|
| Q |
101 |
gaaattataaaacacgtgatagtgagggtgacggcatctcagattgcacctctt |
154 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
5830756 |
gaaattataaaacacgtgatagtggtggtgacagcatctcagattgcacctctt |
5830809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University