View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13881_high_13 (Length: 338)
Name: NF13881_high_13
Description: NF13881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13881_high_13 |
 |  |
|
| [»] scaffold0072 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0072 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: scaffold0072
Description:
Target: scaffold0072; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 1 - 329
Target Start/End: Original strand, 41652 - 41980
Alignment:
| Q |
1 |
cctacccacaaaaggccacccagttaaaaacatcactagatctgagatgatgctgagaagagaaaaaagattatgttattattgtgatgaacgattctct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
41652 |
cctacccacaaaaggccacccagttaaaaacatcactagagctgagatgatgctcagaagagaaaaaggattatgctattattgtgatgaacgattctct |
41751 |
T |
 |
| Q |
101 |
atatctcataaatgtccaaatcgtcattatttcttatttcaaactaaagaagaagaagaacctgacccaccaccaccgcaaatcacaccatcaactgacc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||| |||||||||| ||||||||||||||| |||||| |
|
|
| T |
41752 |
atatctcataaatgtccaaatcgtcattatttcttattccaaactgaagaagaagaagaacctgaaccaccaccacaacaaatcacaccatcagctgacc |
41851 |
T |
 |
| Q |
201 |
ctgaaacaccacctattgttacggaggagcaccacttgtcactgaatgccttgaacggttctgctcgtaaaggcaccatgcggttccacggtcaaattca |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
41852 |
ctgaaacaccacctattgttacggaggagcaccacttgtcactgaatgccttgaacggttctgctcgtaaaggcaccatgcggttccacagtcaaattca |
41951 |
T |
 |
| Q |
301 |
gggtattgctatcacgattttgttggaca |
329 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
41952 |
gggtattgctatcacgattttgttggaca |
41980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University