View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13881_high_15 (Length: 296)
Name: NF13881_high_15
Description: NF13881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13881_high_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 5 - 278
Target Start/End: Original strand, 4778280 - 4778557
Alignment:
| Q |
5 |
gaaatatgctcttgcaatttttaatttatttttaaaatagttcctaaacttgtttacttaatgatttggcaccattttgtttatgtgtcattgactacgc |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| ||||||||||||||||| || |
|
|
| T |
4778280 |
gaaatatgctcttgcaatttttaatttatttttaaaatagttccaaaactcgtttacttaatgatttggcaccattttatttatgtgtcattgactgtgc |
4778379 |
T |
|
| Q |
105 |
agcactattccacgtggcttttaataggattgcataaatat----aaaattaattaatttctttgttggtgacacccggtaccaatgctgctattgccag |
200 |
Q |
| |
|
|| |||||||||||| || |||||||||||||||||||||| |||||||||||||||||||| ||||||||||| ||||||||||||||||||| | |
|
|
| T |
4778380 |
agtactattccacgtagcatttaataggattgcataaatatatataaaattaattaatttctttgctggtgacacccaataccaatgctgctattgccgg |
4778479 |
T |
|
| Q |
201 |
cgctggtgttgatgatgatatcgatgatgttgtcctcaatttcagacatggattctacactgcactgcatactagttt |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4778480 |
cgctggtgttgatgatgatatcgatgatgttatcctcaatttcagacatggattctacactgcactacatactagttt |
4778557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University