View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13881_high_16 (Length: 293)
Name: NF13881_high_16
Description: NF13881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13881_high_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 134; Significance: 9e-70; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 134; E-Value: 9e-70
Query Start/End: Original strand, 1 - 154
Target Start/End: Original strand, 12351174 - 12351327
Alignment:
| Q |
1 |
cacttggttgagttttgtaaccattaacaatgcaggttgttggtattggtgtcataaggtgactatgatgtgggtggttgttggtgtcggtaatacatgg |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
12351174 |
cacttggttgcgttttgtaaccattaacaatggaggttgttggtattggtgtcataaggtgactatgatgtgggtggttgttggtgtcagtaatacatgg |
12351273 |
T |
 |
| Q |
101 |
tggtaattgttggtgttaggttgggagttggaacattaaggatgataatgagga |
154 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
12351274 |
tggtgattgttggtgttaggctgggagttggaacattaaggatgataatgagga |
12351327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 203 - 287
Target Start/End: Original strand, 12351376 - 12351460
Alignment:
| Q |
203 |
tgtctacttgtggtgacctcagatttgggtccatctcgtcgaaagttagtgtctagtttcaagtttttgggttggtgatgatgtc |
287 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
12351376 |
tgtctacttgtgctgacctcagatttgggtccatctcgtcgaaagttagtgtctagtttcaagtttttgggttggttatggtgtc |
12351460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 245 - 278
Target Start/End: Original strand, 30127181 - 30127214
Alignment:
| Q |
245 |
aagttagtgtctagtttcaagtttttgggttggt |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
30127181 |
aagttagtgtctagtttcaagtttttgggttggt |
30127214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University