View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13881_high_20 (Length: 247)
Name: NF13881_high_20
Description: NF13881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13881_high_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 168; Significance: 4e-90; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 56 - 227
Target Start/End: Complemental strand, 17110266 - 17110095
Alignment:
| Q |
56 |
tcattttaaagtgggtccagttcaagtaaatactatttgaatataaatctgcaccacttgatatgagatataccaaaagaaaacatgtaaatagtaggta |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17110266 |
tcattttaaagtgggtccagttcaagtaaatactatttgaatataaatctgcaccacttgatatgagatataccaaaagaaaacatgtaaatagtaggta |
17110167 |
T |
 |
| Q |
156 |
cctgagtaattgttgggcactatgactgttggtccctctcaggatcgtcaatcattatacattgaatctgcg |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
17110166 |
cctgagtaattgttgggcactatgactgttggtccctctcaggatcgtcaatcattatacattgaatatgcg |
17110095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 18 - 57
Target Start/End: Complemental strand, 17110327 - 17110288
Alignment:
| Q |
18 |
aaacactgcatttcagattacaacataaatcccactgatc |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17110327 |
aaacactgcatttcagattacaacataaatcccactgatc |
17110288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University