View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13881_low_14 (Length: 329)
Name: NF13881_low_14
Description: NF13881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13881_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 17 - 259
Target Start/End: Complemental strand, 27119456 - 27119214
Alignment:
| Q |
17 |
caacaactttaataagaacctgatcttccttaacatcaggtacagcaacattggagtcaaatttcaaaacatcaacacctccatattctccatacaccca |
116 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27119456 |
caacaactttaacaagaacctgatcttccttaacatcaggtacagcaacattggagtcaaatttcaaaacatcaacacctccatattctccatacaccca |
27119357 |
T |
 |
| Q |
117 |
agccttcatttcagaaggaacttgtgtcactttcacagcctcagatgaagcagtagtagattgagacttcaccaagaatctagcatgccttgttgaagaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27119356 |
agccttcatttcagaaggaacttgtgtcactttcacagcctcagatgaagcagtagtagattgagacttcaccaagaatctagcatgccttgttgaagaa |
27119257 |
T |
 |
| Q |
217 |
gacaagagagttttgagacaagttttttggttagtttttggtt |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27119256 |
gacaagagagttttgagacaagttttttggttagtttttggtt |
27119214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University