View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13881_low_17 (Length: 290)
Name: NF13881_low_17
Description: NF13881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13881_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 6e-74; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 88 - 276
Target Start/End: Original strand, 42600288 - 42600480
Alignment:
| Q |
88 |
aggagttgacatttctaaggtggctttgttaccacttgatagacttttagaatgtatgtcaata------gaaaagagcacaggtggtttaagttttgat |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| ||||||| |
|
|
| T |
42600288 |
aggagttgacatttctaaggtggctttgttaccacttgatagacttttagaatgtatgtcaataagaatagaaaagaacacaggtggtttaaattttgat |
42600387 |
T |
|
| Q |
182 |
atgaatgagacaatatttgcatgaagtaaagtttatatttcaaatatgcatacgtaatgtgttgctattgtgatatttaaggcatcattcatctc |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42600388 |
ctgaatgagacaatatttgcatgaagtaaagtttagatttcaaatatgcatacttaatgtgt--ctattgtgatatttaaggcatcattcatctc |
42600480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 24 - 103
Target Start/End: Original strand, 42600192 - 42600271
Alignment:
| Q |
24 |
aacaatatctttggctatcatgcaattcaacccagttacgccaatctctttcagaagtagtagtaggagttgacatttct |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
42600192 |
aacaatatctttggctatcatgcaattcaacccaattacgccaatctctttcagaagtagtagtaggtgttgacatttct |
42600271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University