View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13881_low_22 (Length: 243)
Name: NF13881_low_22
Description: NF13881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13881_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 3 - 231
Target Start/End: Complemental strand, 52808222 - 52807994
Alignment:
| Q |
3 |
ccataggctgtaacttaaactttgtttgtaactggtagtttagtttcttaactaaccgatagagttgtttattagtacagccaaacatagttaataaggt |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52808222 |
ccataggctgtaacttaaactttgtttgtaactggtagtttagtttcttaactaaccgatagagttgtttattagtacagccaaacatagttaataaggt |
52808123 |
T |
 |
| Q |
103 |
gattaattaccaattcgcaccacagcaaaataccataattgccaggtttcatccataaaccaatcatgcaagtatttgtttgtcttatgctctaacacca |
202 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52808122 |
gattaattaccaattcgcaccacaacaaaataccataattgccaggtttcatccatagaccaatcatgcaagtatttgtttgtcttatgctctaacacca |
52808023 |
T |
 |
| Q |
203 |
atcaaacatccttctcacattattattat |
231 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
52808022 |
atcaaacatccttctcacattattattat |
52807994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University