View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13882_low_2 (Length: 320)
Name: NF13882_low_2
Description: NF13882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13882_low_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 300; Significance: 1e-169; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 300; E-Value: 1e-169
Query Start/End: Original strand, 1 - 304
Target Start/End: Complemental strand, 8478167 - 8477864
Alignment:
| Q |
1 |
catgcctaaagtttccttcaccattggtggcaaaaaatttgaccttgccccagaagaggtataatttcaaatctatatttacttttgagaaggctgatct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8478167 |
catgcctaaagtttccttcaccattggtggcaaaaaatttgaccttgccccagaagaggtataatttcaaatctatatttacttttgagaaggctgatct |
8478068 |
T |
 |
| Q |
101 |
gatcattgacggtgttttattttcatgaagaatttgccttggatttgttgctttgtgaattgagtaacttttctacgcatgtaatggctgctttgttcca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8478067 |
gatcattgacggtgttttattttcatgaagaatttgccttggatttgttgctttgtgaattgagtaacttttctacgcatgtaatggctgctttgttcca |
8477968 |
T |
 |
| Q |
201 |
tgtttatatgtttccctgatccaatttccatttgctttcttcagtacatattgaaggtgggtgaaggtgctgcagcccaatgcattagtggctttactgc |
300 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8477967 |
tgtttatctgtttccctgatccaatttccatttgctttcttcagtacatattgaaggtgggtgaaggtgctgcagcccaatgcattagtggctttactgc |
8477868 |
T |
 |
| Q |
301 |
tttg |
304 |
Q |
| |
|
|||| |
|
|
| T |
8477867 |
tttg |
8477864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University