View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13882_low_4 (Length: 286)
Name: NF13882_low_4
Description: NF13882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13882_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 97; Significance: 1e-47; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 17 - 121
Target Start/End: Complemental strand, 55076057 - 55075953
Alignment:
| Q |
17 |
atatggatcacaatgtttatccaatttcgttttcaagagtcatttctaatgctaattaggtatgtatgactgtgttacacgtattttgatccagacatta |
116 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55076057 |
atatggatctcaatgtttatccaatttcgttttcaagagtgatttctaatgctaattaggtatgtatgactgtgttacacgtattttgatccagacatta |
55075958 |
T |
 |
| Q |
117 |
tataa |
121 |
Q |
| |
|
||||| |
|
|
| T |
55075957 |
tataa |
55075953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University