View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13884_high_3 (Length: 335)
Name: NF13884_high_3
Description: NF13884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13884_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 1 - 317
Target Start/End: Original strand, 51689351 - 51689678
Alignment:
| Q |
1 |
aaacaatgacgttagcaccgacacttacgattgaagcttctcacgcgtgtccatacgaacgaacacacgtgattacattcaattatttcatgtccggtgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51689351 |
aaacaatgacgttagcaccgacacttatgattgaagcttctcacgcgtgtccatacgaaggaacacacgtgattacattcaattatttcatgtccggtgt |
51689450 |
T |
 |
| Q |
101 |
caatgtg-----------tctggtgtttgtgcttcatagaattgaagtaacttacggtgctagaaatgtgaagaccgggttcagcagattcaaagagaaa |
189 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51689451 |
caatgtgtcagtattgtgtctggtgtttgtgcttcatagaattgaagtaacttacggtgctagaaatgtgaagaccgggttcagcagattcaaagagaaa |
51689550 |
T |
 |
| Q |
190 |
gctaggagcatctctttcatcttctttaaccaaacaccgataagcaagaaccggagtgaggtgatcggaaaatatgcaacggtacagaggaatcacgttc |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51689551 |
gctaggagcatctctttcatcttctttaaccaaacaccgataagcaagaaccggagtgaggtgatcggaaaatatgcaacggtacagaggaatcacgttc |
51689650 |
T |
 |
| Q |
290 |
cctttcttcgaagcttctataaatttat |
317 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
51689651 |
cctttcttcgaagcttctataaatttat |
51689678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University