View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13884_high_4 (Length: 258)
Name: NF13884_high_4
Description: NF13884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13884_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 3e-97; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 60 - 243
Target Start/End: Original strand, 54771558 - 54771741
Alignment:
| Q |
60 |
gggtctataaagaaggtggcattgagtgcctcgagcaagttcaaaaattcattcaccaagaaggggaggaagcacagcagagttatgtctatctgtattg |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54771558 |
gggtctataaagaaggtggcattgagtgcctcgagcaagttcaaaaattcattcaccaagaaggggaggaagcacagcagagttatgtctatctgtattg |
54771657 |
T |
|
| Q |
160 |
aggatagttttgatgcagaagagttacaggcagttgatgcttttcgacaaacacttatcttggaagagctcttaccctcaaagc |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54771658 |
aggatagttttgatgcagaagagttacaggcagttgatgctcttcgacaaacacttatcttggaagagctcttaccctcaaagc |
54771741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 14 - 42
Target Start/End: Original strand, 54771512 - 54771540
Alignment:
| Q |
14 |
aggtcatgagatggaacattctgaggatg |
42 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
54771512 |
aggtcatgagatggaacattctgaggatg |
54771540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 241
Target Start/End: Original strand, 26638407 - 26638473
Alignment:
| Q |
175 |
cagaagagttacaggcagttgatgcttttcgacaaacacttatcttggaagagctcttaccctcaaa |
241 |
Q |
| |
|
|||||||||| |||||| | ||||||||||| ||| |||||||| | ||||| || ||||||||||| |
|
|
| T |
26638407 |
cagaagagttgcaggcaatcgatgcttttcgtcaagcacttatcctagaagaactattaccctcaaa |
26638473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University