View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13885_high_6 (Length: 333)
Name: NF13885_high_6
Description: NF13885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13885_high_6 |
 | |
|
| [»] scaffold0168 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0168 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 21 - 324
Target Start/End: Complemental strand, 18390 - 18087
Alignment:
| Q |
21 |
atagggttgaataactcaaccagtttggtctaaagaatcaaaggagttgaagaattaaagatacatgtttcaagtctaggcaatgnnnnnnnntactaac |
120 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
18390 |
atagggttgaataactcaaccagtttgatctaaagaatcaaaggagttgaagaattaaagatacatgtttcaagtctaggcaatgaaaaaaaatactaac |
18291 |
T |
|
| Q |
121 |
atattaacatttgtcattnnnnnnnntgtatattgcagttgaaagaatttcaattaccaaacttgatagctaagcaaaatcaaggagataattctcaaag |
220 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18290 |
atattaacatttgtcattaaaaaaaatgtatattgcagttgaaagaatttcaattaccaaacttgatagctaagcaaaatcaaggagataattctcaaag |
18191 |
T |
|
| Q |
221 |
cctgacaaagataacacaagtaaggtgaattttatacatactggacggaatacccaagggtttcaccggtttatttaaagactattacttttcccaccct |
320 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||| ||||||||||||| |||| | |
|
|
| T |
18190 |
cctgacaaagataacacaggtaaggtgaattttatacatactagacggaatacccaagggtttcaccggtttatctaaatactattacttttcacacctt |
18091 |
T |
|
| Q |
321 |
atgc |
324 |
Q |
| |
|
|||| |
|
|
| T |
18090 |
atgc |
18087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 298 - 332
Target Start/End: Original strand, 16512595 - 16512629
Alignment:
| Q |
298 |
aagactattacttttcccaccctatgcttctcctc |
332 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
16512595 |
aagactattacttttcccaccctatgcttttcctc |
16512629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University