View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13886_high_10 (Length: 256)

Name: NF13886_high_10
Description: NF13886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13886_high_10
NF13886_high_10
[»] chr3 (1 HSPs)
chr3 (18-144)||(30889825-30889951)


Alignment Details
Target: chr3 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 18 - 144
Target Start/End: Complemental strand, 30889951 - 30889825
Alignment:
18 tataaaaatttaaacgagtgaatttaaatcatacaaaaaatttgtggcaccgattgctcacaccactttcaaaaaatttataaattactaagtatcttgt 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
30889951 tataaaaatttaaacgagtgaatttaaatcatacaaaaaatttgtggcaccgattgctcacaccactttcaaaaaaattataaattactaagtatcttgt 30889852  T
118 agtttggtttggtaagtacttatatgc 144  Q
    |||||||||||||||||||||||||||    
30889851 agtttggtttggtaagtacttatatgc 30889825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University