View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13886_high_10 (Length: 256)
Name: NF13886_high_10
Description: NF13886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13886_high_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 18 - 144
Target Start/End: Complemental strand, 30889951 - 30889825
Alignment:
| Q |
18 |
tataaaaatttaaacgagtgaatttaaatcatacaaaaaatttgtggcaccgattgctcacaccactttcaaaaaatttataaattactaagtatcttgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30889951 |
tataaaaatttaaacgagtgaatttaaatcatacaaaaaatttgtggcaccgattgctcacaccactttcaaaaaaattataaattactaagtatcttgt |
30889852 |
T |
|
| Q |
118 |
agtttggtttggtaagtacttatatgc |
144 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
30889851 |
agtttggtttggtaagtacttatatgc |
30889825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University