View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13886_high_15 (Length: 218)

Name: NF13886_high_15
Description: NF13886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13886_high_15
NF13886_high_15
[»] chr7 (1 HSPs)
chr7 (12-197)||(28525109-28525294)


Alignment Details
Target: chr7 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 12 - 197
Target Start/End: Complemental strand, 28525294 - 28525109
Alignment:
12 aagaatatgaagagaggaacaattcatggctagtgttaggatctaaatatctgtgaaagaatcaatcttctcatgcaacaaaaataaaataggaaaaagt 111  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28525294 aagaaaatgaagagaggaacaattcatggctagtgttaggatctaaatatctgtgaaagaatcaatcttctcatgcaacaaaaataaaataggaaaaagt 28525195  T
112 atagtattccatttcaaaacttctatagactacttttctttaccagtttttgcttatattgtatgaaaaacacatcacttagctaa 197  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28525194 atagtattccatttcaaaacttctatagactacttttctttaccagtttttgcttatattgtatgaaaaacacatcacttagctaa 28525109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University